Human polybromo 1 (2nd bromodomain)

PDB Code 3HMF Target Class Bromodomain

Target PB1
Alias BAF180, MGC156155, MGC156156, PB1, PBRM1
Disease Area/Function cancer, chromatin and epigenetics, signalling
Date Deposited 2009-05-29
Authors Filippakopoulos, P., Picaud, S., Keates, T., Muniz, J., von Delft, F., Arrowsmith, C.H., Edwards, A., Weigelt, J., Bountra, C., Knapp, S.
Related Structure 3G0J, 3IU5, 3IU6, 3K2J, 3MB4, 3TLP

Struc Details Tabs

Structure Details

PB1, also known as BAF180, is a unique subunit of the Polybromo (PBAF) complex. Localisation of PBAF at the kinetochores of mitotic chromosome is consistent with its requirement for cell cycle progression through mitosis (Thompson, 2008). PB1 resembles closely an analogues complex described in yeast containing the subunits Rsc1, Rsc2 and Rsc3 (Xue et al., 2000). Polybromo is composed of 6 Bromodomains, which bind acetylated histones, followed by 2 BAH domains known to act as protein-interaction modules and a C-terminal HMG box. HMGs have been shown to bind nucleosomal DNA. PB1 is widely expressed and thought to target PBAF to chromatin sites, recruit specific effector proteins and alter histone - DNA interactions (Xue et al., 2000), (Thompson, 2008).

The phenotype of PB1 knockout models points to an essential role of this protein in cardiac development. Mouse PB1-/- embryos die during development and show hypoplasia of cardiac ventricular free walls and ventricular septal defect and fail to fail to develop the plexus of coronary vessels. Mice also develop trophoblast placental defects (Wang et al., 2004) (Huang et al., 2008). Truncating mutations of PB1 have been identified in breast cancer suggesting a tumor suppressor role.  Although the precise mechanism for its tumor repressor activity is not known yet it is thought that this occurs at least in part, through its ability to regulate p21 (Xia et al., 2008). Here we report the structure of the second and fifth Bromodomain of PB1 at 1.78 Å and 1.63 Å resolution, respectively.

References

Huang, X., Gao, X., Diaz-Trelles, R., Ruiz-Lozano, P., and Wang, Z. (2008). Coronary development is regulated by ATP-dependent SWI/SNF chromatin remodeling component BAF180. Developmental biology 319, 258-266.

Thompson, M. (2008). Polybromo-1: The chromatin targeting subunit of the PBAF complex. Biochimie.

Wang, Z., Zhai, W., Richardson, J.A., Olson, E.N., Meneses, J.J., Firpo, M.T., Kang, C., Skarnes, W.C., and Tjian, R. (2004). Polybromo protein BAF180 functions in mammalian cardiac chamber maturation. Genes & development 18, 3106-3116.

Xia, W., Nagase, S., Montia, A.G., Kalachikov, S.M., Keniry, M., Su, T., Memeo, L., Hibshoosh, H., and Parsons, R. (2008). BAF180 is a critical regulator of p21 induction and a tumor suppressor mutated in breast cancer. Cancer research 68, 1667-1674.

Xue, Y., Canman, J.C., Lee, C.S., Nie, Z., Yang, D., Moreno, G.T., Young, M.K., Salmon, E.D., and Wang, W. (2000). The human SWI/SNF-B chromatin-remodeling complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes. Proceedings of the National Academy of Sciences of the United States of America 97, 13015-13020.

Materials & Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: PB1A-c014

GenBank GI number: gi|30794372

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACCTGT
ACTTCCAATCCATGAGCCCGGCGTATCTG
AAAGAAATTCTGGAACAGCTGCTGGAAGC
CATCGTTGTTGCGACCAATCCGAGCGGTC
GTCTGATCAGCGAACTGTTTCAGAAACTG
CCGAGCAAAGTGCAGTATCCGGATTATTA
TGCGATCATTAAAGAACCGATTGATCTGA
AAACCATTGCCCAGCGTATCCAGAACGGT
AGCTATAAAAGCATCCACGCCATGGCGAA
AGATATTGATCTGCTGGCGAAAAATGCGA
AAACCTATAATGAACCGGGTAGCCAGGTG
TTTAAAGATGCGAATAGCATTAAAAAAAT
TTTTTATATGAAAAAAGCGGAAATCGAAC
ACCATGAATGACAGTAAAGGTGGATACGG
ATCCGAA

Tags and additions: Cleavable N-terminal His6 tag.

Final protein sequence:
mhhhhhhssgvdlgtenlyfq^sMSPAYL
KEILEQLLEAIVVATNPSGRLISELFQKL
PSKVQYPDYYAIIKEPIDLKTIAQRIQNG
SYKSIHAMAKDIDLLAKNAKTYNEPGSQV
FKDANSIKKIFYMKKAEIEHHE

^ TEV cleave site

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 10 ml from a 50 ml overnight culture containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol were used to inoculate each of two 1 litre cultures of TB containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. Cultures were grown at 37°C until the OD600 reached ~2.5then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD600 of 3.0. The cells were collected by centrifugation and the pellet resuspended in binding buffer and frozen.  Binding buffer:  50 mM HEPES pH 7.5; 500 mM NaCl; 10 mM imidazole, 5% glycerol.

Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5mM TCEP, 1mM PMSF added to the lysate.  Cells were lysed using sonication.  The lysate was centrifuged at 16,500 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole; Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 50 to 250 mM Imidazol , (step elution).

Procedure: Supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 and 250 mM); fractions were collected until essentially all protein was eluted. 

Enzymatic treatment : The N-terminal His tag was cleaved by treatment with TEV protease

Column 2: Size Exclusion Chromatography.  Superdex S75 16/60 HiLoad

Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl, 5% glycerol

Procedure: PB1 was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in  10 mM HEPES, pH 7.5; 500mM NaCl, 5% glycerol using an ÄKTAexpress system.

Column 3: Ni-affinity. Ni-sepharose (Amersham), 2 ml of 50% slurry in a Bio-rad poly-prep column, washed with binding buffer.

Buffers: Binding buffer: 10 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol; Wash buffer: 10 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 250 mM Imidazole.

Procedure: Gel filtration fractions containing PB1 were pooled and loaded by gravity flow on the Ni-sepharose column. After loading a further 4 ml of binding buffer was added and the full flow through was collected.  The column was then washed with 5 ml wash buffer at gravity flow. Finally, 6 ml of elution buffer was added.  Flow through, wash and elution fractions were analysed by SDS PAGE.  The TEV-cleaved PB1protein was mainly found in the wash fraction. 10 mM DTT was added for overnight storage.

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 13213 for this construct as predicted from the sequence of this protein.  

Protein concentration:  Protein was concentrated to 9.8 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallization: Crystals were grown at 4°C in 600 nl sitting drops from a 1:1 & 1:2 ratio of protein to reservoir solution containing 0.01 M ZnCl2; 15 w/v PEG6000; 10 v/v ethylene glycol; 5.5pH MES.

Data Collection: Crystals were cryo-protected using the well solution supplemented with 25% ethylene glycol and flash frozen in liquid nitrogen; X-ray source: Diffraction data were collected from a single crystal on a Rigaku FR-E SuperBright at a single wavelength of 1.5 Å and the structure was refined to 1.63 Å; Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model.